View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10501_low_16 (Length: 348)
Name: NF10501_low_16
Description: NF10501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10501_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 311; Significance: 1e-175; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 15 - 337
Target Start/End: Complemental strand, 29731925 - 29731603
Alignment:
| Q |
15 |
aaatcttcagacggagtagtactgttgctttgcgcagagacagttgcaactgcattggctgcagcaatgatggtaccagtgactataattgccatcttcc |
114 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29731925 |
aaatcttcagagggagtagtactgttgctttgcgcagagacagttgcaactgcattggctgcagcaatgatggtaccagtgactataattgccatcttcc |
29731826 |
T |
|
| Q |
115 |
tattcttggtgttcattgttgttttggtaagtgaaattagggagagcaagaaacggaaacaagaaatgttcttggaaggaaaacacagaaaaataaagaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29731825 |
tattcttggtgttcattgttgttttggtaagtgaaattagggagagcaagaaacggaaacaagaaatgttcttggaaggaaaacacagaaaaataaagaa |
29731726 |
T |
|
| Q |
215 |
cttgtgaaagctgagttgaggaatatgtatcatgaaaatcttataggctctttttataagactgagtttcccgcttatttgcaaaaataacggattctgt |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
29731725 |
cttgtgaaagctgagttgaggaatatgtatcatgaaaatcttataggctctttttataagactgagtttcccgcttatttgcaaaaatgacggattctgt |
29731626 |
T |
|
| Q |
315 |
tttcaaattattttatttttcat |
337 |
Q |
| |
|
|||||| |||||||||||||||| |
|
|
| T |
29731625 |
tttcaagttattttatttttcat |
29731603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 272 - 337
Target Start/End: Original strand, 29741283 - 29741348
Alignment:
| Q |
272 |
aagactgagtttcccgcttatttgcaaaaataacggattctgttttcaaattattttatttttcat |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
29741283 |
aagactgagtttcccgcttatttgcaaaaataacggattctgttttcaagttattttatttttcat |
29741348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University