View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10501_low_25 (Length: 315)
Name: NF10501_low_25
Description: NF10501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10501_low_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 226; Significance: 1e-124; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 35 - 300
Target Start/End: Complemental strand, 41772556 - 41772291
Alignment:
| Q |
35 |
gcaggagtggtggctgctgccacagtgactgcagctcatgtgtctttaatgagtcaagatggtagtggtcatggtggtgaatctggtggggggtagcact |
134 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41772556 |
gcaggagtggtggctgctgccacggtgactgcagctcatgtgtctttaatgagtcaagatggtagtggtcatggtggtgaatctggtggggggtagcact |
41772457 |
T |
 |
| Q |
135 |
ggtacatcgtacatgtttaagttannnnnnnncctagctactactactacttggtttacaatgaaatatttctcatcaaccttgttgtgaaagcttataa |
234 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41772456 |
ggtacatcatacatgtttaagttattttttttcctagctactactaccacttggtttacaatgaaatatttctcatcaaccttgttgtgaaagcttataa |
41772357 |
T |
 |
| Q |
235 |
ataaagcttgattacttctaaattataatggtcctatcctatggagttattatttatgttgaaact |
300 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41772356 |
ataaagcatgattacttctaaattataatggtcctatcctatggagttattatttatgttgaaact |
41772291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 4 - 36
Target Start/End: Original strand, 41774482 - 41774514
Alignment:
| Q |
4 |
ggagaagcatagggattgaagagataaggaggc |
36 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |
|
|
| T |
41774482 |
ggagaaacatagggattgaagagataaggaggc |
41774514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University