View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10501_low_26 (Length: 313)
Name: NF10501_low_26
Description: NF10501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10501_low_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 3e-79; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 147 - 296
Target Start/End: Complemental strand, 2136569 - 2136420
Alignment:
| Q |
147 |
aatgttcaccatttcttctcactcaccccctcttctgtttaagaaacagccttgagagaaacagaatcaaatcctttccttaaccttcacgccttcattt |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2136569 |
aatgttcaccatttcttctcactcaccccctcttctgtttaagaaacagccttgagagaaacagaatcaaatcctttccttaaccttcacgccttcattt |
2136470 |
T |
|
| Q |
247 |
aaaaaggttcaaccttttaaccaatctctgaactctttctttgacccttt |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2136469 |
aaaaaggttcaaccttttaaccaatctctgaactctttctttgacccttt |
2136420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 3 - 64
Target Start/End: Complemental strand, 2136708 - 2136648
Alignment:
| Q |
3 |
gaagtatctgcagaatgtcaacatccgatacgggtacatctccgttttaaattattggggct |
64 |
Q |
| |
|
||||||| || | ||| |||||||||||||||||||||||| | ||||| |||||||||||| |
|
|
| T |
2136708 |
gaagtatatgtataatatcaacatccgatacgggtacatct-cattttagattattggggct |
2136648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University