View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10501_low_27 (Length: 304)
Name: NF10501_low_27
Description: NF10501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10501_low_27 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 138; Significance: 4e-72; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 48 - 299
Target Start/End: Complemental strand, 35394824 - 35394564
Alignment:
| Q |
48 |
gtggttttgtcatcctttatggagtgttccacgtttgttgctaaaactgtaaggtttgtggttgaattctggattttcgcccttgagttggcttgttacg |
147 |
Q |
| |
|
||||||||||||| ||| | |||||||||||||||||||||||||||||||||| ||||||| |||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
35394824 |
gtggttttgtcattttttctcgagtgttccacgtttgttgctaaaactgtaaggtatgtggttcaattatgggttttcgcccttgagttggcttgttacg |
35394725 |
T |
|
| Q |
148 |
atagcgtgttgatcaaacatgattttacgggtaacagatgcaccttcga-------tcgttgttggataaaaagtaattaatatatcttttgtat--nnn |
238 |
Q |
| |
|
|| |||||||||||||||||| |||||| |||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35394724 |
atggcgtgttgatcaaacatggttttacaggtaacagatgcaccttcgattgttgttggttgttggataaaaagtaattaatatatcttttgtataaaaa |
35394625 |
T |
|
| Q |
239 |
nnnnnnnggagttttccttaaagtaattaatataaaaagggtacaaaatatatctctgctt |
299 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
35394624 |
aaaaaaaggagatttccttaaagtaattaatataaaaagggtacaaaatatatctttgctt |
35394564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University