View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10501_low_37 (Length: 275)
Name: NF10501_low_37
Description: NF10501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10501_low_37 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 18 - 270
Target Start/End: Complemental strand, 33503237 - 33502985
Alignment:
| Q |
18 |
gggaggattctcactttggtttggcacattcacaatcttttattttggatcgacatagccaacatcaccatactttagagagaggaaaactattgtgttg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||| ||||||| |
|
|
| T |
33503237 |
gggaggattctcactttggtttggcacattcacaatcttttattttggatcgacatagccaacatcaccacactttggagagaggaaaactactgtgttg |
33503138 |
T |
|
| Q |
118 |
attggccgaccaactttaacttttctttaaattctttaaattatactattatgtggactcctcctaatgaacttctttgataatgtttttagaatttaca |
217 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
33503137 |
attggccgaccaaccttaacttttctttaaattctttaaattatactattatgtggactcctcctaatgaacttcttggataatgttttcagaatttaca |
33503038 |
T |
|
| Q |
218 |
tgtttaaaaatgtttgtttaatttcatagttttactttaaacttcatctctct |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33503037 |
tgtttaaaaatgtttgtttaatttcatagttttactttaaacttcatctctct |
33502985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 193 - 250
Target Start/End: Original strand, 3782528 - 3782585
Alignment:
| Q |
193 |
tttgataatgtttttagaatttacatgtttaaaaatgtttgtttaatttcatagtttt |
250 |
Q |
| |
|
||||||||| ||| ||||||||||||| |||||| ||| |||||||||| ||||||| |
|
|
| T |
3782528 |
tttgataatatttctagaatttacatgcctaaaaacgttcgtttaatttcttagtttt |
3782585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University