View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10501_low_45 (Length: 251)
Name: NF10501_low_45
Description: NF10501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10501_low_45 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 1 - 247
Target Start/End: Original strand, 37028349 - 37028597
Alignment:
| Q |
1 |
ttcttaaaaaataaataaattattttggcttcttnnnnnnnn--caataatannnnnnnncttcaactgttattttttattttacaactaagaagagtta |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
37028349 |
ttcttaaaaaataaataaattattttggcttcttcttaaaaaaacaataatattttttttcttcaactgttattctttattttacaactaagaagagtta |
37028448 |
T |
 |
| Q |
99 |
aaatctaacggaagatgttagactgccacaacataacgaattaagattcaattgaaatatgtatgttgtcgagaccagatcgcaaagtcgaatatttcaa |
198 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
37028449 |
aaatctaacggaagatgttagactaccacaacatggcgaattaagattcaattaaaatatgtatgttgtcgagaccagaacgcaaagtcgaatatttcaa |
37028548 |
T |
 |
| Q |
199 |
actcagctagttggactcacttccaccttggtgtccccctttgcttctc |
247 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
37028549 |
actcagctagttggactcacttccatcttggtgtccccttttgcttctc |
37028597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University