View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10501_low_46 (Length: 250)
Name: NF10501_low_46
Description: NF10501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10501_low_46 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 16 - 239
Target Start/End: Original strand, 15907345 - 15907562
Alignment:
| Q |
16 |
catttccctcaaaagggtcaagcaattagtccatctttttcttaattggcaagtcaccattgcatttgacttgaatgccaaggtaaatcaatatggaatc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
15907345 |
catttccctcaaaagggtcaagcaattagtccatctttttcttaattggcaagtcgctattgcatttgacttaaatgccaaggt-aatcaatatggaatc |
15907443 |
T |
|
| Q |
116 |
atttcaagcattccaaactaatgagaaactcgtggagagaggatgctatattctatttagttttgacttctgctcaaagcattgtgaaacttcaacacac |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
15907444 |
atttcaagcattccaaactaatgagaaactcgtg--gagagggtgctatattctatttagttttgacttttgctcaaagc---gtgaaacttcaacacat |
15907538 |
T |
|
| Q |
216 |
ctattctttgaatgtgcatttcat |
239 |
Q |
| |
|
||| |||| ||||| |||| |||| |
|
|
| T |
15907539 |
ctaatcttcgaatgcgcatctcat |
15907562 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University