View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10501_low_48 (Length: 250)
Name: NF10501_low_48
Description: NF10501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10501_low_48 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 1 - 142
Target Start/End: Complemental strand, 27154856 - 27154715
Alignment:
| Q |
1 |
atgatgatgatgatgaagatgtaggagatttctccgggggaggcagtgacggaggtggttgtttacggagagaattaggaggagatgataaagcagaagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27154856 |
atgatgatgatgatgaagatgtaggagatttctccgggggaggcagtgacggaggtggttgtttacggagagaattaggaggagatgataaagcagaagc |
27154757 |
T |
|
| Q |
101 |
agaatattgcacattgggcattggtggcggaggaggtaaagc |
142 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
27154756 |
agaatattgcacattgggcaatggtggtggaggaggtaaagc |
27154715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University