View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10501_low_59 (Length: 241)
Name: NF10501_low_59
Description: NF10501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10501_low_59 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 5129719 - 5129506
Alignment:
| Q |
1 |
ccatacaataggtagggttatgaaagttcttgttttaggatgcaaatgatgtcttttctttttattgtaaaatttaatctctgttcattagtcattatct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
5129719 |
ccatacaataggtagggttatgaaagttcttgttttaggatgaaaatgatgtcttttcttttt-ttgtaaactttaatctctgttcattagtcattatct |
5129621 |
T |
|
| Q |
101 |
atggttttcggagaatgacttgctaccttgttaccttcattaggaaaaacaagacagttctttatcattcagtttcctgatgtcttatatatgcttttct |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||| || | | || | |||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5129620 |
atggttttcagagaatgacttgctaccttgttgcc--gagtgcttaatgc---tcagt--tttatcattcagtttcctgatgtcttatatatgcttttct |
5129528 |
T |
|
| Q |
201 |
tcatctatcttgtcttcttagt |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
5129527 |
tcatctatcttgtcttcttagt |
5129506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University