View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10501_low_68 (Length: 238)
Name: NF10501_low_68
Description: NF10501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10501_low_68 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 57 - 221
Target Start/End: Complemental strand, 13070457 - 13070295
Alignment:
| Q |
57 |
cttaaagaaaaagtgagagaaatacattgaaatgg---aaagataaggtaaatgcacactaggatttcatttcttatttactgatatatacggtcaaaga |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13070457 |
cttaaagaaaaagtgagagaaatacattgaaatggttcaaagataaggtaaatgcacactaggatttcatttcttatttactgatatatacggtcaaaga |
13070358 |
T |
|
| Q |
154 |
tgcagtgtcaaactcatgaactcgcacaattcattatatatgaaccctgagggagtagggacacttgt |
221 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
13070357 |
tgcagtgt----ctcatgaactcacacaattcattatatatgtaccct-agggagtagggacacttgt |
13070295 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 5 - 60
Target Start/End: Complemental strand, 13071356 - 13071301
Alignment:
| Q |
5 |
aatttaaccatttgtatactttaacactctagattcaaatataagtcgttttctta |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
13071356 |
aatttaaccatttgtatactttaacactctagattcaaatataagttgttttctta |
13071301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University