View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10501_low_73 (Length: 230)
Name: NF10501_low_73
Description: NF10501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10501_low_73 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 49591747 - 49591518
Alignment:
| Q |
1 |
gatgccaaaaagaatggccaacaaaatcaggtactacatattaatattatggttctaaactgtagttgtagtcgtggttgccgttgcgatgtgaacctta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
49591747 |
gatgccaaaaagaatggccaacaaaatcaggtactacatattaatattatggttctaaactgtagttgtagtcgtggttgcagttgcgatgtgaacctta |
49591648 |
T |
|
| Q |
101 |
atattgcgccaaaatgctaacaaatgaggtagccacttcaactagtggagttcgtaactggtcaatatgtcgatccatcaactgcgatcagttctcagtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49591647 |
atattgcgccaaaatgctaacaaatgaggtagccacttcaactagtggagttcgtaactggtcaatatgtcgatccatcaactgcgatcagttctcagtt |
49591548 |
T |
|
| Q |
201 |
atttggttcaattgtggtctaatagattga |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
49591547 |
atttggttcaattgtggtctaatagattga |
49591518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 67
Target Start/End: Original strand, 7236166 - 7236232
Alignment:
| Q |
1 |
gatgccaaaaagaatggccaacaaaatcaggtactacatattaatattatggttctaaactgtagtt |
67 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |||| || ||||| |||||| | ||||||| |
|
|
| T |
7236166 |
gatgctaaaaagaatggccaacaaaatcaggtactatatatcaacattatagttctacattgtagtt |
7236232 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 138 - 199
Target Start/End: Original strand, 7236451 - 7236512
Alignment:
| Q |
138 |
tcaactagtggagttcgtaactggtcaatatgtcgatccatcaactgcgatcagttctcagt |
199 |
Q |
| |
|
||||||||| |||||||||||||||||||| || ||| | |||| ||||||| |||||||| |
|
|
| T |
7236451 |
tcaactagttgagttcgtaactggtcaataagtagattgaccaaccgcgatcaattctcagt |
7236512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 87 - 119
Target Start/End: Original strand, 7236240 - 7236272
Alignment:
| Q |
87 |
cgatgtgaaccttaatattgcgccaaaatgcta |
119 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |
|
|
| T |
7236240 |
cgatgtgaaccttaatattacgccaaaatgcta |
7236272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University