View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10501_low_75 (Length: 227)
Name: NF10501_low_75
Description: NF10501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10501_low_75 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 12 - 209
Target Start/End: Complemental strand, 39504539 - 39504342
Alignment:
| Q |
12 |
aagcaaagggaactacacttgaggacattcggccgaacctcggcaaaattcttgctctattaacacttactaatagaaatactaatnnnnnnnntattta |
111 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
39504539 |
aagcaaagggaattacacttgaggacattcggccgaaccttggcaaaattcttgctccattaacacttactaatagaaatactaataaaaaaaatattta |
39504440 |
T |
 |
| Q |
112 |
ggcattaacatgtatctatgtgatttggttcggtttggttcaatcttgtaaaatcaacccaaaatcagatccgagcagtttttaatcaaggacatcca |
209 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
39504439 |
ggcattaacatgtatctatatgatttggttcggtttggttcaatcttgaaaaatcaacctaaaatcagatccgagcagtttttaaacaaggacatcca |
39504342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University