View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10501_low_8 (Length: 390)
Name: NF10501_low_8
Description: NF10501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10501_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 9e-86; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 9e-86
Query Start/End: Original strand, 116 - 316
Target Start/End: Complemental strand, 40224410 - 40224210
Alignment:
| Q |
116 |
agttgttatgttcaggagttaataggattagaggaaacttgttttcctgccacactggttgggtaatgggttatggattatgcttttagctcgtgtggga |
215 |
Q |
| |
|
|||||||| | ||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
40224410 |
agttgttaggatcaggagttaataagattagaggaatcttgttttcctgccacactggttgggtaatgggttatggattatgcttttagcttgtgtggga |
40224311 |
T |
|
| Q |
216 |
ttttgtcggaaatgagccctgattgttgatgtcacacattttcgtcagtttaatcatttgttttctatatagagatggatatttctctccttttgtcaat |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
40224310 |
ttttgtcggaaatgagccctgattgttgatgtcacaaatttttgtcagtttaatcatttgttttctgtatagagatggatatttccttccttttgtcaat |
40224211 |
T |
|
| Q |
316 |
t |
316 |
Q |
| |
|
| |
|
|
| T |
40224210 |
t |
40224210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 34 - 69
Target Start/End: Complemental strand, 40224434 - 40224399
Alignment:
| Q |
34 |
ggaatctaatattgttttgtttttagttgttaggat |
69 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
40224434 |
ggaatctaatattgttgtgtttttagttgttaggat |
40224399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 91; Significance: 5e-44; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 17 - 176
Target Start/End: Complemental strand, 36314597 - 36314435
Alignment:
| Q |
17 |
agtatatgtgcttcatagg----aatctaatattgttttgtttttagttgttaggatacttagcatttagccgctagtatggagatttaatatcagagat |
112 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||| |||||||| |||||||||||| || | ||||||||||||| ||||||||| |
|
|
| T |
36314597 |
agtatatgtgcttcataggttggaatctaatattgttgtgtttttagtttttaggatatttagcatttagcggcaattatggagatttaaaatcagagat |
36314498 |
T |
|
| Q |
113 |
ttaagttgttatgttcaggagttaataggattagaggaaacttgttttcctgccacactggttg |
176 |
Q |
| |
|
|| ||||||||||||| ||||||||||||||||||||| |||||||| |||||| |||||||| |
|
|
| T |
36314497 |
ttctgttgttatgttcacgagttaataggattagaggaatcttgtttt-ctgccagactggttg |
36314435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 254 - 315
Target Start/End: Complemental strand, 36314420 - 36314359
Alignment:
| Q |
254 |
ttttcgtcagtttaatcatttgttttctatatagagatggatatttctctccttttgtcaat |
315 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
36314420 |
ttttcgtcagttttatcatttgttttctgtatagagatggatatttctctccttttgtcaat |
36314359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University