View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10501_low_81 (Length: 218)
Name: NF10501_low_81
Description: NF10501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10501_low_81 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 171
Target Start/End: Original strand, 2223719 - 2223882
Alignment:
| Q |
1 |
ttattatttaatgatgatcgatcagccagatcttccggatgaaagagaaaggattgaagcagcaggtggaagagtgattgattggaatgggaatcgtgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2223719 |
ttattatttaatgatgatcgatcagccagatcttccggatgaaagagaaaggattgaagcagcaggtggaagagtgattgattggaatgggaatcgtgtt |
2223818 |
T |
|
| Q |
101 |
ttaggagtactcgcaacttccagatcaataggtacgtacgtacttataataaaataatgatatacatgcat |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
2223819 |
ttaggagtactcgcaacttccagatcaatag----gtacgtacttataataa---aatgatatacatgcat |
2223882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University