View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10501_low_82 (Length: 217)
Name: NF10501_low_82
Description: NF10501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10501_low_82 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 13 - 199
Target Start/End: Original strand, 11181480 - 11181666
Alignment:
| Q |
13 |
aagaaaaaattgaaaacttggagactaaactttctgaaacattggcaaaagagtatactattgatatggagattcaaagattaattgatgaaaaaagtga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11181480 |
aagaaaaaattgaaaacttggagactaaactttctgaaacattggcaaaagagtatactattgatatggagattcaaagattaattgatgaaaaaagtga |
11181579 |
T |
 |
| Q |
113 |
gattcttgctcagaagaactttcttgaatctcaacttgataagtacactcaagtggtatctaaggactatgaaaaatggaaaggttt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11181580 |
gattcttgctcagaagaactttcttgaatctcaacttgataagtacactcaagtggtatctaaggactatgaaaaatggaaaggttt |
11181666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University