View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10501_low_85 (Length: 203)
Name: NF10501_low_85
Description: NF10501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10501_low_85 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 95 - 187
Target Start/End: Original strand, 8328847 - 8328939
Alignment:
| Q |
95 |
ctcaagcctaatttactggtggattagtactgaggaaaaccattttttcaaatacatgacaagtactataaaatgtctcataagactttttct |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8328847 |
ctcaagcctaatttactggtggattagtactgaggaaaaccattttttcaaatacatgacaagtactataaaatgtctcataagactttttct |
8328939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 13 - 64
Target Start/End: Original strand, 8328679 - 8328733
Alignment:
| Q |
13 |
agatgaattcaaattgaatattct---ttttaccgtcaaacacagcaaaagttgt |
64 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
8328679 |
agatgaattcaaattgaatattcttctttttaccgtcaaacacagcaaaagttgt |
8328733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University