View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10502_low_11 (Length: 226)
Name: NF10502_low_11
Description: NF10502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10502_low_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 13 - 207
Target Start/End: Complemental strand, 36982077 - 36981882
Alignment:
| Q |
13 |
caaaggaataagattgaaacaagtatcaaaatttacttaaacctaaaaatcatacaaattatcgtaaaaccgaaagcgaagcaacaaagtaaaagtaatt |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36982077 |
caaacgaataagattgaaacaagtatcaaaatttacttaaacctaaaaatcatacaaattatcgtaaaaccgaaagcgaagcaacaaagtaaaagtaatt |
36981978 |
T |
|
| Q |
113 |
agag-nnnnnnnnnnnnnnnnnnncgaaccatgtctggatttcttgaatcccccattgttgttgaatccatgttcgggtcttcctctcttgcgcat |
207 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36981977 |
agagaaaaaaagattaaaaaaaaacgaaccatgtctggatttcttgaatcccccattgttgttgaatccatgttcgggtcttcctctcttgcgcat |
36981882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University