View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10502_low_12 (Length: 225)

Name: NF10502_low_12
Description: NF10502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10502_low_12
NF10502_low_12
[»] chr4 (2 HSPs)
chr4 (1-218)||(56012666-56012883)
chr4 (26-91)||(56012583-56012648)
[»] chr7 (1 HSPs)
chr7 (105-191)||(19923767-19923853)
[»] chr2 (1 HSPs)
chr2 (114-208)||(9687542-9687636)


Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 56012666 - 56012883
Alignment:
1 tttcaggcttttttggcttctctggttctttgggcttttcaggctctttgggcttgacgggttccttgggcttttctggttctttaggcttgggaggtgg 100  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
56012666 tttcagggttttttggcttctctggttctttgggcttttcaggctctttgggcttgacgggttccttgggcttttctggttctttaggcttgggaggtgg 56012765  T
101 aggaggttcgacaatttctatgcttttgatggcaccacaacctttgcaacaaatcttgtctcttatcttctcggggctacaacaaaccactgtgattgtc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
56012766 aggaggttcgacaatttctatgcttttgatggcaccacaacctttgcaacaaatcttgtctcttatcttctcggggctacaacaaaccactgtgattgtc 56012865  T
201 acgatgttgttcatctca 218  Q
    |||||||||||| |||||    
56012866 acgatgttgttcttctca 56012883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 26 - 91
Target Start/End: Original strand, 56012583 - 56012648
Alignment:
26 ttctttgggcttttcaggctctttgggcttgacgggttccttgggcttttctggttctttaggctt 91  Q
    ||||||||| || |||||||||||||||||  | || |||||||||||||| |||||||| |||||    
56012583 ttctttgggtttctcaggctctttgggcttttcaggctccttgggcttttcaggttctttgggctt 56012648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 105 - 191
Target Start/End: Complemental strand, 19923853 - 19923767
Alignment:
105 ggttcgacaatttctatgcttttgatggcaccacaacctttgcaacaaatcttgtctcttatcttctcggggctacaacaaaccact 191  Q
    ||||| || ||||||||||||||||||| |||||  ||||  |||||||| |||||||||| |||||| ||||| || || ||||||    
19923853 ggttcaactatttctatgcttttgatggtaccacccccttgacaacaaatattgtctcttaccttctctgggctgcagcacaccact 19923767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 114 - 208
Target Start/End: Original strand, 9687542 - 9687636
Alignment:
114 atttctatgcttttgatggcaccacaacctttgcaacaaatcttgtctcttatcttctcggggctacaacaaaccactgtgattgtcacgatgtt 208  Q
    ||||| ||||| ||||| | ||| | ||||||| |||||| |||||| || |||||||| || |||||||| ||||| ||||||||||| |||||    
9687542 atttcaatgctcttgatagaacctccacctttgtaacaaagcttgtccctaatcttctcaggactacaacacaccaccgtgattgtcacaatgtt 9687636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University