View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10502_low_14 (Length: 201)
Name: NF10502_low_14
Description: NF10502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10502_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 13 - 184
Target Start/End: Original strand, 26473763 - 26473934
Alignment:
| Q |
13 |
gcaaaggacaagttagtaatatatctcaaactaacactgttgaattgaagaatagtctgtgttgtgttgttttttattgtcttgtgcaatattttgcagg |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
26473763 |
gcaaaggacaagttagtaatatatctcaaactaacactgttgaattgaagaatagtctgtgttgtgttgttttttattgtcttgtgcaatatttttcagg |
26473862 |
T |
 |
| Q |
113 |
cattgaataacatggggagtatttatgtggactgtggtaaaatagaacttgcaaaggaatgctacaacaatg |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26473863 |
cattgaataacatggggagtatttatgtggactgtggtaaaatagaacttgcaaaggaatgctacaacaatg |
26473934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University