View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10503_14 (Length: 316)
Name: NF10503_14
Description: NF10503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10503_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 2e-95; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 6 - 182
Target Start/End: Complemental strand, 3739607 - 3739431
Alignment:
| Q |
6 |
gatacctgctttgtaataggcaatagaggtgaacattttataactcaaatcaaagtgtttttgcggagggttgcaccaaacgtcagtggtcttgctgtaa |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3739607 |
gatacctgctttgtaataggcaatagaggtgaacattttataactcaaatcaaagtgtttttgcggagggttgcaccaaacgtcagtggtcttgctgtaa |
3739508 |
T |
|
| Q |
106 |
tctggaggacaaaaatttgttgcggttatcgtgatagggcttgcaccctttatgcaccattgaggatcgtcgacaca |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3739507 |
tctggaggacaaaaatttgttgcggttatcgtgatagggcttgcaccctttatgcaccattgaggatcgtcgacaca |
3739431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 6 - 166
Target Start/End: Complemental strand, 3745324 - 3745164
Alignment:
| Q |
6 |
gatacctgctttgtaataggcaatagaggtgaacattttataactcaaatcaaagtgtttttgcggagggttgcaccaaacgtcagtggtcttgctgtaa |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| || ||||| ||||||||||||||||| || |||||||| ||| ||||| |||| |
|
|
| T |
3745324 |
gatacctgctttgtaataggcaatagaggtgaacattttatagcttaaatcgaagtgtttttgcggaggattacaccaaacatcatgagtcttagagtaa |
3745225 |
T |
|
| Q |
106 |
tctggaggacaaaaatttgttgcggttatcgtgatagggcttgcaccctttatgcaccatt |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
3745224 |
tctggaggacaaaaatttgttgcggttatcgtgattgggtgtgcaccctttatgcaccatt |
3745164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 6 - 175
Target Start/End: Complemental strand, 3732256 - 3732087
Alignment:
| Q |
6 |
gatacctgctttgtaataggcaatagaggtgaacattttataactcaaatcaaagtgtttttgcggagggttgcaccaaacgtcagtggtcttgctgtaa |
105 |
Q |
| |
|
|||||| ||||||||||| ||||||||||| |||||||||||||| | |||||||||||| | || || || |||||| ||||| | |||| ||||| |
|
|
| T |
3732256 |
gataccagctttgtaataagcaatagaggtaaacattttataacttaggtcaaagtgttttagtgggggattacaccaattttcagttggcttgttgtaa |
3732157 |
T |
|
| Q |
106 |
tctggaggacaaaaatttgttgcggttatcgtgatagggcttgcaccctttatgcaccattgaggatcgt |
175 |
Q |
| |
|
| ||||||||||||||||||||| || | ||||| || | |||| | ||||||||||||||||| |||| |
|
|
| T |
3732156 |
tttggaggacaaaaatttgttgcagtcactgtgattggacctgcatcttttatgcaccattgagggtcgt |
3732087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 92; Significance: 1e-44; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 188 - 287
Target Start/End: Complemental strand, 8682843 - 8682744
Alignment:
| Q |
188 |
tgctcgttcactggctgtggtgctggcttcacttcctctacttttgtgccaccacctgcatttttaccaccgccttcattggccgttttgttgtcatcac |
287 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8682843 |
tgctctttcactggctgtggtgctggcttcacttcctctacttttgagccaccacctgcatttttaccaccgccttcattggccgttttgttgtcatcac |
8682744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University