View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10503_4 (Length: 460)
Name: NF10503_4
Description: NF10503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10503_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 415; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 415; E-Value: 0
Query Start/End: Original strand, 27 - 449
Target Start/End: Original strand, 30957686 - 30958108
Alignment:
| Q |
27 |
agaccgtacattcaccggcgaggagagttttttgaccggaaaagtatcgccgatgagaacgtcgagacgagtgaaaaacggccagggactctggtaaccg |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30957686 |
agaccgtacattcaccggcgaggagagttttttgaccggaaaagtatcgccgatgagaacgtcgagacgagtgaaaaacggccagggactctggtaaccg |
30957785 |
T |
|
| Q |
127 |
ccgtcggattcggaaaccctagctttctcgatcttgtacttcttcttcaacgtgtcgattcggtttttgcactgaacgtcggtacgtcgagctttcctgt |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30957786 |
ccgtcggattcggaaaccctagctttctcgatcttgtacttcttcttcaacgtgtcgattcggtttttgcactgaacgtcggtacgtcgagctttcctgt |
30957885 |
T |
|
| Q |
227 |
taccggcggcgtggacgtcgttgacggcgtcggcgacctcttgccaagttttctgacggaggtttccgcggttgaggtcgaggtagcgttcaccccaggc |
326 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
30957886 |
taccggcggcgtggaagtcgttgacggcgtcggcgacctcttgccaagttttctgacggaggttaccgcggttgaggtcgaggtagcgttcaccccaggc |
30957985 |
T |
|
| Q |
327 |
gtcgatgagggtggaagttgcgtcttcggtccagcagtcttcgcggccggagtacggcgatgacaacggaagacgcggcggaacggagtggattggtgac |
426 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30957986 |
gtcgatgagggtggaagttgcgtcttcggtccagcagtcttcgcggccggagtacggcgatgacaacggaagacgcggcggaacggagtggattggtgac |
30958085 |
T |
|
| Q |
427 |
ggagctccggcgatgatgtccat |
449 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
30958086 |
ggagctccggcgatgatgtccat |
30958108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University