View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10504_16 (Length: 309)
Name: NF10504_16
Description: NF10504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10504_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 1 - 299
Target Start/End: Complemental strand, 12012085 - 12011787
Alignment:
| Q |
1 |
cctcgaacacgcttctagaatcttctcctccttacacaaacccaattcattcatgtggaacactctcatccgcgctcatcaacaacaacaaccccgcatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||| |||| |
|
|
| T |
12012085 |
cctcgaacacgcttctagaatcttctcctccttacacaaacccaattcattcatgtggaacactctcatccgcgcgcatcaacaacaacagccccacatt |
12011986 |
T |
|
| Q |
101 |
tctctctccctttacattcaaatgcgtagacacggtgctatccctggtaaacacactttcccttttctcctcaaagcttgttcttcgctctcaaatgttt |
200 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
12011985 |
tctctttccctttacattcaaatgcgtagacacggtgttatccctggtaaacacactttcccttttctcctcaaagcttgttcttcgctatcaaatgttt |
12011886 |
T |
|
| Q |
201 |
tgccacattgtaaacaggttcatgcacatgtggtgaaatttgggttgtgttttgattgtcatgtggggaatgggttggttcgtgggtactctgtctctg |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||| ||||| |||| |
|
|
| T |
12011885 |
tgccacattgtaaacaggttcatgcacatgtggtgaaattcgggttgtgttttgattgtcatgtggggaatggtttggttcgtgggtattctgtttctg |
12011787 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University