View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10505_high_10 (Length: 249)
Name: NF10505_high_10
Description: NF10505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10505_high_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 9965619 - 9965861
Alignment:
| Q |
1 |
ctttgtagcttcttgttatcacagtggaaatggatctggacgagcgttttccttcattggacgtgaatcatttctgaagatgctctaatgttttccctca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9965619 |
ctttgtagcttcttgttatcacagtggaaatggatttcgacgagcgttttccttcattggacgtgaatcatttctgaagatgctctaatgttttccctca |
9965718 |
T |
|
| Q |
101 |
gtgaacctttcctagagtacatatagggcaaaatgtagacgttaccaactagaaatttgattagtttgacaaactc--tgttagaatttcgacttaacag |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
9965719 |
gtgaacctttcctagagtacatatagggcaaaatgtagacgttaccaactagaagtttgattagtttgacaaactcagtgttagaatttcgacttaacag |
9965818 |
T |
|
| Q |
199 |
gattgaattcttttgctttcgttttctttattgggtctctgct |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
9965819 |
gattgaattcttttgctttcgttttctttattgggtttctgct |
9965861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 24 - 65
Target Start/End: Original strand, 34096619 - 34096660
Alignment:
| Q |
24 |
gtggaaatggatctggacgagcgttttccttcattggacgtg |
65 |
Q |
| |
|
|||||||||||| || ||| |||||||||||||||||||||| |
|
|
| T |
34096619 |
gtggaaatggatgtgaacgtgcgttttccttcattggacgtg |
34096660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University