View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10505_high_22 (Length: 226)
Name: NF10505_high_22
Description: NF10505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10505_high_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 19 - 208
Target Start/End: Original strand, 32087957 - 32088146
Alignment:
| Q |
19 |
tcacatgattttggaaaatttttcggtaaccgttcaatcatcccctgcacctccccgctatcataaatcttcttcaaatcatcaacaccgcctatatatt |
118 |
Q |
| |
|
|||||||| ||||| ||| ||||||||||||||||||||||| |||||| ||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32087957 |
tcacatgaatttggtaaagttttcggtaaccgttcaatcatctcctgcaactcaccgctatcataaatcttcttcaaatcatcaacaccgcctatatatt |
32088056 |
T |
 |
| Q |
119 |
cacctccgatgaacacacacggcagaggaacattccgacgactgagaatctgttgaagctcttcacgaaacttttcgtcgacgcagacat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32088057 |
cacctccgatgaacacacacggcagaggaacattccgacgactgagaatctgttgaagctcttcacgaaacttttcgtcgacgcagacat |
32088146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University