View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10505_low_12 (Length: 300)
Name: NF10505_low_12
Description: NF10505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10505_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 108; Significance: 3e-54; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 106 - 217
Target Start/End: Original strand, 7063655 - 7063766
Alignment:
| Q |
106 |
taatattagtatttaaattactaattaaatttgagttttagtttaacgtcactagagtaatacaacactcccttttaacactttatatttaacgcttcat |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7063655 |
taatattagtatttaaattactaattaaatttgagttttagtctaacgtcactagagtaatacaacactcccttttaacactttatatttaacgcttcat |
7063754 |
T |
 |
| Q |
206 |
cttttacaagac |
217 |
Q |
| |
|
|||||||||||| |
|
|
| T |
7063755 |
cttttacaagac |
7063766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 251 - 282
Target Start/End: Original strand, 7063767 - 7063798
Alignment:
| Q |
251 |
tcaaaatggtaagaccgacccaaattttactt |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
7063767 |
tcaaaatggtaagaccgacccaaattttactt |
7063798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University