View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10505_low_14 (Length: 257)
Name: NF10505_low_14
Description: NF10505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10505_low_14 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 48 - 173
Target Start/End: Complemental strand, 28596550 - 28596425
Alignment:
| Q |
48 |
aaaagtatagagtggtactaatacagtcatcaatcaaagggtgtacccctcctttaacttaaatgacatagccggatttttggtctcactaacggttgaa |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28596550 |
aaaagtatagagtggtactaatacagtcatcaatcaaagggtgtacccctcctttaacttaaatgacatagccggatttttggtctcactaacggttgaa |
28596451 |
T |
|
| Q |
148 |
atgacataaaaaaccttaggtaagca |
173 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
28596450 |
atgacataaaaaaccttaggtaagca |
28596425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University