View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10505_low_18 (Length: 251)
Name: NF10505_low_18
Description: NF10505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10505_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 106; Significance: 4e-53; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 9 - 114
Target Start/End: Complemental strand, 39085633 - 39085528
Alignment:
| Q |
9 |
accaaaggtatcttttgcacataattttagagattaatcgttataactaaatcaatggtatcttctgcacgtgactttagtgattgaactatggacaaat |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39085633 |
accaaaggtatcttttgcacataattttagagattaatcgttataactaaatcaatggtatcttctgcacgtgactttagtgattgaactatggacaaat |
39085534 |
T |
 |
| Q |
109 |
ttaaat |
114 |
Q |
| |
|
|||||| |
|
|
| T |
39085533 |
ttaaat |
39085528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 183 - 251
Target Start/End: Complemental strand, 39083473 - 39083405
Alignment:
| Q |
183 |
tccgagcaaagctaatttttgtaaactgagacaataacacaaactttagacgataacaaaaactttttc |
251 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39083473 |
tccgggcaaagctaatttttgtaaaccgagacaataacacaaactttagacgataacaaaaactttttc |
39083405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 9 - 82
Target Start/End: Complemental strand, 31728516 - 31728438
Alignment:
| Q |
9 |
accaaaggtatcttttgcacataattttagagattaatc-----gttataactaaatcaatggtatcttctgcacgtga |
82 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||| || |||| |||| |
|
|
| T |
31728516 |
accaaatgtatcttttgcacataattttagagattaatctttaagttataactaaatcaatggtattttttgcatgtga |
31728438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University