View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10505_low_27 (Length: 238)
Name: NF10505_low_27
Description: NF10505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10505_low_27 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 9965526 - 9965315
Alignment:
| Q |
1 |
tgactttgtagcttttgaaaaattaaagtgggtgattttgataaaattgccgttatacccaacatgtacaatgtgtagtttaatgagaaacacatgtttg |
100 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9965526 |
tgactttgtagcttttgcaaaattaaagtgggtgattttgataaaattgccgttataccaaacatgtacaatgtgtagtttaatgagaaacacatgtttg |
9965427 |
T |
|
| Q |
101 |
caattgcctcaccgtggaaacaaacacatactcaagtgatacaaccatacatcaaattagacataaaattagttgtatcttgcaacatttttatcaaacc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
9965426 |
caattgcctcaccgtggaaacaaacacatactcaagtgatacaaccatacataaaattaga-----------ttgtatcttgcaacatttttatcaaacc |
9965338 |
T |
|
| Q |
201 |
ccaaaagaaggaagagtactttc |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
9965337 |
ccaaaagaaggaagagtactttc |
9965315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 96 - 131
Target Start/End: Complemental strand, 34096618 - 34096583
Alignment:
| Q |
96 |
gtttgcaattgcctcaccgtggaaacaaacacatac |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
34096618 |
gtttgcaattgcctcaccgtggaaacaaacacatac |
34096583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University