View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10505_low_28 (Length: 238)
Name: NF10505_low_28
Description: NF10505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10505_low_28 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 382174 - 382396
Alignment:
| Q |
1 |
ccatggaaacaatagaaatattatagtacattacctatttcataagcaatacatccaataaaaatgatcaaattacattgcccttaaaaagatcttagtt |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
382174 |
ccatggaaacaatagagatattatagtacattacctatttcataagcaatacatccaataaaaatgatcaaattacattgcccttaaaaagatcttagtt |
382273 |
T |
|
| Q |
101 |
acttcataagattagtctctaccctagttttccatgaaaaacaaaattacattgtcatatgtgctctcaacctttaaattaccattcccgacgacacatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
382274 |
acttcataagattagtctctaccctagttttccatgaaaaacaaaattacattgtcatatgtgctctcaacctttaaattgccattcccgacgacacatt |
382373 |
T |
|
| Q |
201 |
gggcaatgtgcttgtgaggtttg |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
382374 |
gggcaatgtgcttgtgaggtttg |
382396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 50; Significance: 9e-20; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 159 - 220
Target Start/End: Original strand, 1022594 - 1022655
Alignment:
| Q |
159 |
atgtgctctcaacctttaaattaccattcccgacgacacattgggcaatgtgcttgtgaggt |
220 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1022594 |
atgttctctcaacctttaaattgccattcccgacggcacattgggcaatgtgcttgtgaggt |
1022655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 79
Target Start/End: Original strand, 1022477 - 1022538
Alignment:
| Q |
18 |
atattatagtacattacctatttcataagcaatacatccaataaaaatgatcaaattacatt |
79 |
Q |
| |
|
||||||||||| |||| || | || ||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
1022477 |
atattatagtatattagctgatacaaaagcaatgcatccaatacaaatgatcaaattacatt |
1022538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University