View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10505_low_30 (Length: 231)
Name: NF10505_low_30
Description: NF10505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10505_low_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 1 - 211
Target Start/End: Complemental strand, 52873584 - 52873381
Alignment:
| Q |
1 |
tatgggtggggaagttactctcatttatcatcaacacagcagtagcacccactgactgtgataatgtagctttagttgtgtagtcgcagttaccacgaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52873584 |
tatgggtggggaagttactctcatttatcatcaacacagcagtagcacccactgactgtgataatgtagctttagttgtgtagtcgcagttaccacgaac |
52873485 |
T |
 |
| Q |
101 |
acaaacagcaactgatccagataactgcagtgcgaaagaaagnnnnnnnnnngtttaaatatgttcttagtccttaaaattattttaacattttgtttta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||| | ||||||||||||||||||| ||||| |||||||| ||||||||||| |
|
|
| T |
52873484 |
acaaacagcaactgatccagataactgcagtgcaaaaaaaa-------aaggggttaaatatgttcttagtccctaaaactattttaatattttgtttta |
52873392 |
T |
 |
| Q |
201 |
gttccactaaa |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
52873391 |
gttccactaaa |
52873381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University