View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10505_low_33 (Length: 228)
Name: NF10505_low_33
Description: NF10505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10505_low_33 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 5e-89; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 7 - 180
Target Start/End: Original strand, 26657860 - 26658033
Alignment:
| Q |
7 |
ctaactacatatcaacacatgaccggcccgagggtaaggtcaccaagacaattgccttataccgcttttgtaataaaaaggtctcatatttaaatttgcc |
106 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26657860 |
ctaactacatatcaacacatgaccggcccaagggtaaggtcaccaagacaattgccttagaccgcttttgtaataaaaaggtctcatatttaaatttgcc |
26657959 |
T |
 |
| Q |
107 |
agcctcatacaatgttggtccggccctgtatcagtatattttgggtaagggtggatgtgatattaacgtttgtg |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26657960 |
agcctcatacaatgttggtccggccctgtatcagtatattttgggtaagggtggatgtgatattaacgtttgtg |
26658033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 198 - 228
Target Start/End: Original strand, 26658084 - 26658114
Alignment:
| Q |
198 |
cttctgttttcgtgatcagttgaagccaata |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
26658084 |
cttctgttttcgtgatcagttgaagccaata |
26658114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University