View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10505_low_41 (Length: 204)
Name: NF10505_low_41
Description: NF10505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10505_low_41 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 19 - 186
Target Start/End: Original strand, 30412869 - 30413036
Alignment:
| Q |
19 |
cttcggcggtgtcaaaggtacctagccagacgcggcttttcttaccgggatcgcgaatctcagcggcgtaacggccccatggtcgctttcttacgccgcg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30412869 |
cttcggcggtgtcaaaggtacctagccagacgcggcttttcttaccgggatcgcgaatctcggcggcgtaacggccccatggtcgctttcttacgccgcg |
30412968 |
T |
|
| Q |
119 |
aaagtgaatctcggttgcattgttgttgttgttggaaggtttcttgattttgagattcacggcgttct |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
30412969 |
aaagtgaatctcggttgcattgttgttgttgttggaaggtttcttgattttgagattcgcggcgttct |
30413036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 27 - 106
Target Start/End: Complemental strand, 4035406 - 4035327
Alignment:
| Q |
27 |
gtgtcaaaggtacctagccagacgcggcttttcttaccgggatcgcgaatctcagcggcgtaacggccccatggtcgctt |
106 |
Q |
| |
|
|||||||| ||||| ||||| || || ||||||| | ||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
4035406 |
gtgtcaaatgtacccagccaaacacgcgttttcttccacggatcgcgaatctcagcggcgtagcgtccccatggtcgctt |
4035327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 19 - 112
Target Start/End: Original strand, 32867633 - 32867726
Alignment:
| Q |
19 |
cttcggcggtgtcaaaggtacctagccagacgcggcttttcttaccgggatcgcgaatctcagcggcgtaacggccccatggtcgctttcttac |
112 |
Q |
| |
|
|||| |||||||| || || || |||||||| || |||| ||||| || || || ||||||||||||||||| |||||||| || |||||||| |
|
|
| T |
32867633 |
cttcagcggtgtcgaatgttccaagccagacacgtgtttttttacctgggtcacggatctcagcggcgtaacgaccccatggacgttttcttac |
32867726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University