View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10506_high_12 (Length: 208)
Name: NF10506_high_12
Description: NF10506
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10506_high_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 92 - 193
Target Start/End: Complemental strand, 29909010 - 29908909
Alignment:
| Q |
92 |
tctgcagacccgtgctggtgctgatagcagtttttatatgttatctgatgttgctcctggaaaggagtcttggagattcattgttcgtgtggtgcatctg |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29909010 |
tctgcagacccgtgctggtgctgatagcagttttgatctgttatctgatgctgctcctggaaaggagtcttggagattcattgttcgtgtggtgcgtctg |
29908911 |
T |
 |
| Q |
192 |
tg |
193 |
Q |
| |
|
|| |
|
|
| T |
29908910 |
tg |
29908909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 20 - 91
Target Start/End: Complemental strand, 29909171 - 29909100
Alignment:
| Q |
20 |
aaaccgttttggctgcttgtgctctgttgttctataaattgggctggtttgtttttgtgttttcacactcat |
91 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
29909171 |
aaaccgttttggctgcttgtgctctgttgttctataaattgggctagtttgtttttgtgttttcacactcat |
29909100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University