View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10506_low_11 (Length: 245)
Name: NF10506_low_11
Description: NF10506
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10506_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 11 - 223
Target Start/End: Original strand, 9020060 - 9020272
Alignment:
| Q |
11 |
cagagaaagaacctttgttttgggaatagcttcaatctcatcgcgaaaccggtccttaatcgattgaacttgaagctccatagcactcacagcagcatca |
110 |
Q |
| |
|
|||||||| |||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
9020060 |
cagagaaataaccttggttttgggaatagcttcaatctcatcgcgaaaccgatccttaatcgattgcacttgaagctccatagcactcacagcagcatca |
9020159 |
T |
 |
| Q |
111 |
acagctgaaagatctgcaatactactggctgggtacactacaacaacacatacgcagattcatctaaattaacaaatcaagtaaataataaagacccaat |
210 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
9020160 |
acagccgaaagatctgcaatactactcgctgggtacactacaacaacacatatgcaaattcatctaaattaacaaatcaagtaaagaataaagacccaat |
9020259 |
T |
 |
| Q |
211 |
ttggtcctcacaa |
223 |
Q |
| |
|
||| ||||||||| |
|
|
| T |
9020260 |
ttgatcctcacaa |
9020272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University