View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10506_low_15 (Length: 235)
Name: NF10506_low_15
Description: NF10506
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10506_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 13 - 217
Target Start/End: Original strand, 47592485 - 47592689
Alignment:
| Q |
13 |
gcaaaggtggatctggagaagtttacaaggtgagaaaacatgacaaagtttatttatttgattttatgacaaagttctatgtataaatgatggtttgttt |
112 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47592485 |
gcaaaggtggatttggagaagtttacaaggtgagaaaacatgacaaagtttatttatttgattttatgacaaagttctatgtataaatgatggtttgttt |
47592584 |
T |
|
| Q |
113 |
tctaagggaattctttttgatggacgacacatagctgttaaatggctttcatcaaattcaaagcaaggcatagtcgagttcaagaatgaaattttattga |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47592585 |
tctaagggaattctttttgatggacgacacatagctgttaagaggctttcatcaaattcaaagcaaggcatagtcgagttcaagaatgaaattttattga |
47592684 |
T |
|
| Q |
213 |
tagcc |
217 |
Q |
| |
|
||||| |
|
|
| T |
47592685 |
tagcc |
47592689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 188 - 217
Target Start/End: Complemental strand, 21968693 - 21968664
Alignment:
| Q |
188 |
gagttcaagaatgaaattttattgatagcc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
21968693 |
gagttcaagaatgaaattttattgatagcc |
21968664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 188 - 217
Target Start/End: Complemental strand, 22086586 - 22086557
Alignment:
| Q |
188 |
gagttcaagaatgaaattttattgatagcc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
22086586 |
gagttcaagaatgaaattttattgatagcc |
22086557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University