View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10506_low_18 (Length: 229)

Name: NF10506_low_18
Description: NF10506
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10506_low_18
NF10506_low_18
[»] chr4 (1 HSPs)
chr4 (7-203)||(40429369-40429576)


Alignment Details
Target: chr4 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 7 - 203
Target Start/End: Complemental strand, 40429576 - 40429369
Alignment:
7 catattccaatagtttatgactctatcgtgatcaaggtgaatccagac-----------ttctaacgtaatgacacgaaggacgtgacaaaggtgttaca 95  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |           ||||||| || |||||||||||||||||||| |||||||||    
40429576 catattccaatagtttatgactctatcgtgatcaaggtgaatccagccagacttctaagttctaacatagtgacacgaaggacgtgacaatggtgttaca 40429477  T
96 gtactggattgtcgtttatgggatggggagttggcgagccttgtttcgggtccatgcaagggcaagtgaactagacaattttggacaaaccccaaaacaa 195  Q
    ||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40429476 gtactggattgtcgtttatgggatggggaattggcgtgccttgtttcgggtccatgcaagggcaagtgaactagacaattttggacaaaccccaaaacaa 40429377  T
196 ttttatat 203  Q
    ||||||||    
40429376 ttttatat 40429369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University