View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10506_low_18 (Length: 229)
Name: NF10506_low_18
Description: NF10506
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10506_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 7 - 203
Target Start/End: Complemental strand, 40429576 - 40429369
Alignment:
| Q |
7 |
catattccaatagtttatgactctatcgtgatcaaggtgaatccagac-----------ttctaacgtaatgacacgaaggacgtgacaaaggtgttaca |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| | ||||||| || |||||||||||||||||||| ||||||||| |
|
|
| T |
40429576 |
catattccaatagtttatgactctatcgtgatcaaggtgaatccagccagacttctaagttctaacatagtgacacgaaggacgtgacaatggtgttaca |
40429477 |
T |
 |
| Q |
96 |
gtactggattgtcgtttatgggatggggagttggcgagccttgtttcgggtccatgcaagggcaagtgaactagacaattttggacaaaccccaaaacaa |
195 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40429476 |
gtactggattgtcgtttatgggatggggaattggcgtgccttgtttcgggtccatgcaagggcaagtgaactagacaattttggacaaaccccaaaacaa |
40429377 |
T |
 |
| Q |
196 |
ttttatat |
203 |
Q |
| |
|
|||||||| |
|
|
| T |
40429376 |
ttttatat |
40429369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University