View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10506_low_8 (Length: 251)
Name: NF10506_low_8
Description: NF10506
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10506_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 62; Significance: 7e-27; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 19 - 144
Target Start/End: Original strand, 11635645 - 11635773
Alignment:
| Q |
19 |
acttttgagtagttttatctttgtgaaatagtgttgatttttt--atgaacaatgttggcnnnnnnnngggtgtaaacc-ggtatcctccgcgtgcgcag |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
11635645 |
acttttgagtagttttatctttgtgaaatagtgttgatttttttaatgaacattgttggcttttttttccatgtaaaccgggtatcctccgcgtgcgcag |
11635744 |
T |
|
| Q |
116 |
ttgcggagactaatccattgagccttgtg |
144 |
Q |
| |
|
| |||||||||||||||| |||||||||| |
|
|
| T |
11635745 |
tcgcggagactaatccatcgagccttgtg |
11635773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 154 - 190
Target Start/End: Original strand, 11635917 - 11635953
Alignment:
| Q |
154 |
tcttgagaagattggtttatgatacatctatggctat |
190 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
11635917 |
tcttgagaacattggtttatggtacatctatggctat |
11635953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University