View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10507_low_3 (Length: 240)
Name: NF10507_low_3
Description: NF10507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10507_low_3 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 47969152 - 47968929
Alignment:
| Q |
18 |
gaaataacattcacagaaggaaagacaaaggcatgatggtattgatgttctattgtcttgagaggtagccagccacggaggagtttcatgcttgtggctc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47969152 |
gaaataacattcacagaaggaaagacaaaggcatgatggtattgatgttctattgtcttgagaggtagccagccacggaggagtttcatgcttgtggctc |
47969053 |
T |
 |
| Q |
118 |
acatcaaatgccaaattttcaacaacacaatttcatt-ttttgttccataaataaaaatgttcaattggcttcaannnnnnnagcaaaacaatcaatttg |
216 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
47969052 |
acatcaaatgccaaattttcaacaccacaatttcatttttttgttccataaataaaaatgttctattggcttcaacttttttagcaaaacgatcaatttg |
47968953 |
T |
 |
| Q |
217 |
atctctcacaattttcttgtaaat |
240 |
Q |
| |
|
|||||||||||||||||| ||||| |
|
|
| T |
47968952 |
atctctcacaattttcttataaat |
47968929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University