View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10507_low_4 (Length: 240)
Name: NF10507_low_4
Description: NF10507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10507_low_4 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 17 - 240
Target Start/End: Complemental strand, 7610324 - 7610101
Alignment:
| Q |
17 |
aaacacaagtatccagttataattgaagacagtacgttactggatatgtacctcctgtgaatcaaggccttctaaacttttgatggtgatatcagcaact |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7610324 |
aaacacaagtatccagttataattgaagacagtacgttactggatatgtacctcctgtgaatcaaggccttctaaacttttgatggtgatatcagcaact |
7610225 |
T |
 |
| Q |
117 |
ataactgatgaagcagtactaaataggctttgcattcgagtgtcaattgtatctggacatgatttagagagacagagagatggattaatgaaatgcgtag |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7610224 |
ataactgatgaagcagtactaaataggctttgcattcgagtgtcaattgaatctgtacatgatttagagagacagagagatggattaatgaaatgcgtag |
7610125 |
T |
 |
| Q |
217 |
atatgatatgattttgcaattact |
240 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
7610124 |
atatgatatgattttgcaattact |
7610101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University