View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10507_low_6 (Length: 225)
Name: NF10507_low_6
Description: NF10507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10507_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 20 - 194
Target Start/End: Original strand, 22382997 - 22383171
Alignment:
| Q |
20 |
gatgataccattttgacagctctaatgggtactgatatcgaagttatggttgcgattccgaatgtcatgttgagcaagattagtaacagtcctatggatg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22382997 |
gatgataccattttgacagctctaatgggtactgatatcgaagttatggttgcgattccgaatgtcatgttgagcaagattagtaacagtcctatggatg |
22383096 |
T |
|
| Q |
120 |
ctgattcttgggtttatgagaatgttactgcttacttgttcagaggtggtgtcagtatcaagttagttcagtact |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
22383097 |
ctgattcttgggtttatgagaatgttactgcttacttgttcagaggtggtgtcaatatcaagttagttcagtact |
22383171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University