View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10508_low_9 (Length: 257)
Name: NF10508_low_9
Description: NF10508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10508_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 94; Significance: 6e-46; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 1 - 117
Target Start/End: Original strand, 6251883 - 6251997
Alignment:
| Q |
1 |
atgatagaaatgggatttgtgaattgatgatgatatatcaaaaacacaaagatgaagtatgagaggctctcaacacgattgaattttaaagggagtgaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||| |||||||||||||||| | |
|
|
| T |
6251883 |
atgatagaaatgggatttgtgaattgatgatgatatatcaaaaatacaaagatgaagtatgagaggctctca--acgattggattttaaagggagtgagc |
6251980 |
T |
|
| Q |
101 |
agccgtggacccacaaa |
117 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
6251981 |
agccgtggacccacaaa |
6251997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 15 - 106
Target Start/End: Original strand, 6111730 - 6111819
Alignment:
| Q |
15 |
atttgtgaattgatga-tgatatatcaaaaacacaaagatgaagtatgagaggctctcaacacgattgaattttaaagggagtgaacagccgt |
106 |
Q |
| |
|
||||||||| |||||| |||||||||| ||||||||||||| || || ||||||||||||| |||| |||||||||||||||| ||||||| |
|
|
| T |
6111730 |
atttgtgaagtgatgaatgatatatcagaaacacaaagatgtagcat-tgaggctctcaaca--attggattttaaagggagtgagcagccgt |
6111819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 118 - 149
Target Start/End: Original strand, 6186195 - 6186226
Alignment:
| Q |
118 |
agtttgatattcgtagaacttgcatatcacct |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
6186195 |
agtttgatattcgtagaacttgcatatcacct |
6186226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 118 - 149
Target Start/End: Original strand, 6192711 - 6192742
Alignment:
| Q |
118 |
agtttgatattcgtagaacttgcatatcacct |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
6192711 |
agtttgatattcgtagaacttgcatatcacct |
6192742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 204 - 239
Target Start/End: Original strand, 6252002 - 6252037
Alignment:
| Q |
204 |
ctatcactagtattttctacatgtaaatggtcaatt |
239 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6252002 |
ctatccctagtattttctacatgtaaatggtcaatt |
6252037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University