View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10509_low_3 (Length: 205)
Name: NF10509_low_3
Description: NF10509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10509_low_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 165; Significance: 2e-88; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 8057615 - 8057420
Alignment:
| Q |
1 |
ctatatactttataaggaacatc-gggtaacattcttttatgatgttaaggtcaatagatgcaaacaaaggttctcgttctccctgtaaacatacatgaa |
99 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8057615 |
ctatatactttataaggaacatccgggtaacattcttttatgatgttaaggtcaatagatgcaaacaaaggttctcgttctccctgtaaacatacatgaa |
8057516 |
T |
|
| Q |
100 |
agaggcagatgaaactatactcctgaggaggaggagtagtaggagtataatgattacgatggtgaatggcagggaacgcgtcggagaagaaagaacgata |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8057515 |
agaggcagatgaaactatactcctgaggaggagg---------agtataatgattacgatggtgaatggcagggaacgcgtcggagaagaaagaacgata |
8057425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 158 - 205
Target Start/End: Original strand, 7500561 - 7500608
Alignment:
| Q |
158 |
atggtgaatggcagggaacgcgtcggagaagaaagaacgataaccacc |
205 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||| ||||| |||||||| |
|
|
| T |
7500561 |
atggtgaatggaaggaaacgcgtcggagaagaaggaacggtaaccacc |
7500608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University