View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1050_high_6 (Length: 241)
Name: NF1050_high_6
Description: NF1050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1050_high_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 18 - 233
Target Start/End: Complemental strand, 46449422 - 46449207
Alignment:
| Q |
18 |
tgaacagccacttaagttaaaatgtattagaaatacttattcaaatatcactgctactcacttcttgtaagaagtctgctacattttttctctcaggaca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46449422 |
tgaacagccacttaagttaaaatgtattagaaatacttattcaaatatcactgctactcacttcttgtaagaagtctgctacattttttctctcaggaca |
46449323 |
T |
|
| Q |
118 |
actgaatcccataagtttgaaaaattcaatagcagcctcacgcggcccctgatatacaatctgaccctcggacaacagaatgacatcatcaaacaattca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46449322 |
actgaatcccataagtttgaaaaattcaatagcagcctcacgcggcccctgatatacaatctgaccctcggacaacagaatgacatcatcaaacaattca |
46449223 |
T |
|
| Q |
218 |
taggtctgtggtgctg |
233 |
Q |
| |
|
||||||| ||| |||| |
|
|
| T |
46449222 |
taggtctctggagctg |
46449207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University