View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1050_low_4 (Length: 336)
Name: NF1050_low_4
Description: NF1050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1050_low_4 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 144; Significance: 1e-75; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 79 - 234
Target Start/End: Complemental strand, 10072323 - 10072168
Alignment:
| Q |
79 |
cataggcaagttctccttctctagatctcggaatttacctagctcttaagagaaagacatgaattaatattttgtatagatattattagttcaaaacgat |
178 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10072323 |
catagacaagttctccttctctagatctcggaatttacctagctcttatgagaaagacatgaattaatattttgtatagatattattagttcaaaacgat |
10072224 |
T |
 |
| Q |
179 |
gaaattcgtagcacttgatccatggaaagtatggattctatattcaatgatagaaa |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
10072223 |
gaaattcgtagcacttgatccatggaaagtatggattctatattcagtgatagaaa |
10072168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 99 - 184
Target Start/End: Complemental strand, 10103780 - 10103697
Alignment:
| Q |
99 |
ctagatctcggaatttacctagctcttaagagaaagacatgaattaatattttgtatagatattattagttcaaaacgatgaaatt |
184 |
Q |
| |
|
|||||||| |||| |||| ||||||||| | | |||| ||||||||||||| |||||||| |||||||||||| |||||||||| |
|
|
| T |
10103780 |
ctagatcttggaagttacgtagctcttatggggaagagatgaattaatatt--gtatagattatattagttcaaagcgatgaaatt |
10103697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University