View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1050_low_5 (Length: 336)
Name: NF1050_low_5
Description: NF1050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1050_low_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 146; Significance: 7e-77; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 146; E-Value: 7e-77
Query Start/End: Original strand, 77 - 234
Target Start/End: Complemental strand, 10072325 - 10072168
Alignment:
| Q |
77 |
atcataggcaagttctccttctctagatctcggaatttacctagctcttaagagaaagacatgaattaatattttgtatagatattattagttcaaaacg |
176 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10072325 |
atcatagacaagttctccttctctagatctcggaatttacctagctcttatgagaaagacatgaattaatattttgtatagatattattagttcaaaacg |
10072226 |
T |
 |
| Q |
177 |
atgaaattcgtagcacttgatccatggaaagtatggattctatattcaatgatagaaa |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
10072225 |
atgaaattcgtagcacttgatccatggaaagtatggattctatattcagtgatagaaa |
10072168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 99 - 184
Target Start/End: Complemental strand, 10103780 - 10103697
Alignment:
| Q |
99 |
ctagatctcggaatttacctagctcttaagagaaagacatgaattaatattttgtatagatattattagttcaaaacgatgaaatt |
184 |
Q |
| |
|
|||||||| |||| |||| ||||||||| | | |||| ||||||||||||| |||||||| |||||||||||| |||||||||| |
|
|
| T |
10103780 |
ctagatcttggaagttacgtagctcttatggggaagagatgaattaatatt--gtatagattatattagttcaaagcgatgaaatt |
10103697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University