View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1050_low_9 (Length: 211)

Name: NF1050_low_9
Description: NF1050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1050_low_9
NF1050_low_9
[»] chr4 (1 HSPs)
chr4 (1-108)||(46449315-46449422)


Alignment Details
Target: chr4 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 1 - 108
Target Start/End: Original strand, 46449315 - 46449422
Alignment:
1 gattcagttgtcctgagagaaaaaatgtagcagacttcttacaagaagtgagtagcagtgatatttgaataagtatttctaatacattttaacttaagtg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46449315 gattcagttgtcctgagagaaaaaatgtagcagacttcttacaagaagtgagtagcagtgatatttgaataagtatttctaatacattttaacttaagtg 46449414  T
101 gctgttca 108  Q
    ||||||||    
46449415 gctgttca 46449422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University