View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10511_high_15 (Length: 250)
Name: NF10511_high_15
Description: NF10511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10511_high_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 5e-68; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 1 - 131
Target Start/End: Complemental strand, 39918482 - 39918352
Alignment:
| Q |
1 |
caccattttcacgaaaccattgttccattttctctaccagttttagccctattcccattcttctatgatttggagaaactcttaagcctaaaacgtaggc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39918482 |
caccattttcacgaaaccattgttccattttctctaccagttttagccctattcccattcttctatgatttggagaaactcttaagcctaaaacgtaggc |
39918383 |
T |
 |
| Q |
101 |
tagttttgtgaaaacagggacatgattggaa |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
39918382 |
tagttttgtgaaaacagggacatgattggaa |
39918352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 180 - 242
Target Start/End: Complemental strand, 39918303 - 39918241
Alignment:
| Q |
180 |
ccgcatgtaacggttttgatacaacctcgtatcattccgactgtctcattgcctatctctgct |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39918303 |
ccgcatgtaacggttttgatacaacctcgtatcattccgactgtctcattgcctatctctgct |
39918241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University