View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10511_high_17 (Length: 238)
Name: NF10511_high_17
Description: NF10511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10511_high_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 11 - 222
Target Start/End: Original strand, 27630926 - 27631137
Alignment:
| Q |
11 |
aaagtgaagatggattgcgaaggatgtgaaagaaaagtgaagaaatcagtggaagggatgaaaggagtgacacaagtggaagtagatcgcaaagcaagca |
110 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27630926 |
aaagtgaagatggattgcgaaggatgcgaaagaaaagtgaagaaatcagtggaagggatgaaaggagtgacacaagtggaagtagatcgcaaagcaagca |
27631025 |
T |
 |
| Q |
111 |
aagtaacagtcacaggctacgtggaaccttccaaggtggtggcacgcatgtctcatcgtacagggaaaagggttgagctatggccttatgttccatacga |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27631026 |
aagtaacagtcacaggctacgtggaaccttccaaggtggtggcacgcatgtctcatcgtacagggaaaagggttgagctatggccttatgttccatacga |
27631125 |
T |
 |
| Q |
211 |
tgttgttgcaca |
222 |
Q |
| |
|
|||||||||||| |
|
|
| T |
27631126 |
tgttgttgcaca |
27631137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 11 - 93
Target Start/End: Complemental strand, 8930992 - 8930910
Alignment:
| Q |
11 |
aaagtgaagatggattgcgaaggatgtgaaagaaaagtgaagaaatcagtggaagggatgaaaggagtgacacaagtggaagt |
93 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||||||||||||||||| ||||| ||||||||| |||||||||| |
|
|
| T |
8930992 |
aaagtgaagatggattgcgaagggtgtgaaagaagggtgaagaaatcagtggaaggcatgaagggagtgacaaaagtggaagt |
8930910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 10 - 80
Target Start/End: Complemental strand, 55191008 - 55190938
Alignment:
| Q |
10 |
gaaagtgaagatggattgcgaaggatgtgaaagaaaagtgaagaaatcagtggaagggatgaaaggagtga |
80 |
Q |
| |
|
||||||||||||||| ||||||||||| || |||||||||| | || |||||||| |||||||| |||| |
|
|
| T |
55191008 |
gaaagtgaagatggactgcgaaggatgcgagagaaaagtgagaaggtcggtggaaggaatgaaaggtgtga |
55190938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University