View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10511_low_17 (Length: 303)
Name: NF10511_low_17
Description: NF10511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10511_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 134; Significance: 9e-70; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 134; E-Value: 9e-70
Query Start/End: Original strand, 144 - 289
Target Start/End: Complemental strand, 47425731 - 47425586
Alignment:
| Q |
144 |
ttacactaaagtgaaagcttcttgtataacgaatccttaatcgcattagttactcacatatccaagacacttgattagtagtatggtgtccaaactcact |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47425731 |
ttacactaaagtgaaagcttcttgtataacaaatccttaatcgcattagttactcacatatccaagacacttgattagtagtatggtgtccaaactcact |
47425632 |
T |
 |
| Q |
244 |
tgtgtggttgttcaacgcttaatatggatggttatttgggctcccc |
289 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
47425631 |
tgtgtggttgttcaacactcaatatggatggttatttgggctcccc |
47425586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 47425874 - 47425813
Alignment:
| Q |
1 |
tagtcattctccatgaatatgacgatctttctttccacttctcatctcattcaaccttgtat |
62 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47425874 |
tagtcattcttcatgaatatgacgatctttctttccacttctcatctcattcaaccttgtat |
47425813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University