View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10511_low_19 (Length: 289)
Name: NF10511_low_19
Description: NF10511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10511_low_19 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 1 - 289
Target Start/End: Original strand, 35743915 - 35744200
Alignment:
| Q |
1 |
ggcggtggtggtggaggtgccgagggtggtaatatctgtacnnnnnnnggcattatcgtgaatggtgcaggtaggggaggagggggtgggggagaagatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||| || ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35743915 |
ggcggtggtggtggaggtgccgagggtggtaatatctgtactttttttggcatcat---gaatggtgcaggtaggggaggagggggtgggggagaagatg |
35744011 |
T |
 |
| Q |
101 |
aagaaatagacattgatgcttgttgcagatgagaaggtgtttgtgttggtttaggagaatttggttgaaattgtttaggagatagtggtaactccacttc |
200 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35744012 |
aagaaatagacattgatgcttgttgtagatgagaaggtgtttgtgttggtttaggagaatttggttgaaattgtttaggagatagtggtaactccacttc |
35744111 |
T |
 |
| Q |
201 |
ttccataacttgatcatgtttaaccattttttgatgatgatcatcctcatttgtgtccaaatcacagacaagatcctctgatgtatcct |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35744112 |
ttccataacttgatcatgtttaaccattttttgatgatgatcatcctcatttgtgtccaaatcacagacaagatcctctgatgtatcct |
35744200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University